dna

(redirected from DNA gyrase)
Also found in: Dictionary, Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to DNA gyrase: Topoisomerase, Quinolones

DNA

n. scientifically, deoxyribonucleic acid, a chromonal double chain (the famous "double helix") in the nucleus of each living cell the combination of which determines each individual's hereditary characteristics. In law, the importance is the discovery that each person's DNA is different and is found in each living cell, so a hair, blood, skin or any part of the body can be used to identify and distinguish an individual from all other people. DNA testing can result in proof of one's involvement or lack of involvement in a crime scene. While recent DNA tests have proved a convicted killer on death row did not commit a crime and resulted in his release, current debate concerns whether DNA evidence is scientifically certain enough to be admitted in trials. The trend is strongly in favor of admission.

dna

noun authentication, certification, confirmation of identity, proof of identity, scientific evidence, scientific means of designation, scientific means of identity, scientific means to distinguish a person, scientific method to reveal identity, substantiation, validation of identity, verification of identity, deoxyribonucleic acid
Associated concepts: appeal of a case, DNA fingerprint, DNA polymerase, forensics, overturning a case, reversal of a case

DNA

abbreviation for deoxyribonucleic acid, a chemical which is found in virtually every cell in the body and which carries genetic information. Except for identical twins, each person's DNA is unique. DNA profiling doesn't allow the examination of every single difference between people's DNA so the concentration will be on those aspects which are most likely to yield a difference. DNA can be extracted from any cells that contain a structure called the nucleus, for example, blood, semen, saliva or hair.

Mitochondrial DNA is inherited only from a person's mother. Brothers and sisters have the same mitochondrial DNA type as their mother. This feature of mitochondrial DNA can be used for body identification. The γ-chromosome is present only in men and is largely unchanged as it passes through the male line of a family. The usefulness of the technique in criminal matters is vastly enhanced by the extent to which it is possible to compare a sample with other individuals. To this end there is a National DNA Database maintained by the ASSOCIATION OF CHIEF POLICE OFFICERS and managed by the FORENSIC SCIENCE SERVICE. Techniques vary. There is a UK offence of DNA theft. It is also of assistance in paternity matters.

References in periodicals archive ?
meningitidis isolates showed resistance to ciprofloxacin, the DNA gyrase A quinolone-resistance-determining regions (QRDRs) of 2 ciprofloxacin-sensitive and 7 ciprofloxacin-resistant meningococcal strains from this outbreak and 2 reference strains were sequenced.
Novel Ser79Leu and Ser81Ile substitutions in the quinolone resistance-determining regions of ParC topoisomerase IV and GyrA DNA gyrase subunits from recent fluoroquinolone-resistant Streptococcus pneumoniae clinical isolates.
We analyzed, by DNA sequencing, the DNA gyrase and topoisomerase IV genes of the first reported highly fluoroquinolone-resistant S.
The first 2 mutations were in the gyrA gene, which encodes DNA gyrase, at codon 83 (TCC to TTC), which substitutes phenylalanine for serine, and at codon 87 (GAC to AAC), which substitutes asparagine for aspartic acid.
In general, resistance to fluoroquinolone is chromosome-mediated, involves mutations in one or both target genes encoding DNA gyrase and topoisomerase IV, and tends to develop in a stepwise manner.
Molecular characterization of the gene encoding the DNA gyrase A subunit of Streptococcus pneumoniae.
A single point mutation in gyrA encoding the bacterial DNA gyrase was sufficient to confer high-level resistance (7,8).
The compound under research, diospyrin, binds to a novel site on a well-known enzyme, called DNA gyrase, and inactivates the enzyme.
Identification of pathogenic Leptospira species by conventional or real-time PCR and sequencing of the DNA gyrase subunit B encoding gene.
The new drug target is a protein called DNA gyrase B, found in bacteria that cause TB infections.
Oligonucleotides used in real-time reverse transcription PCRs for Acinetobacter baumannii, Spain * Sequence, Primer Gene 5' [right arrow] 3' TonB-Forw TonB-dependent receptor GGACTGGTGATAAAGCACTAT TonB-Rev TonB-dependent receptor GCCGCATAGAGTTATCACATC Septicolysin-Forw Septicolysin CACCATCTTGTACCAATACATTT Septicolysin-Rev Septicolysin GAAATTAGCAGAAGCTCTCTTAC rpoB-Forw RNA polymerase subunit B CAGCCGCGAYCAGGTTGACTACA rpoB-Rev RNA polymerase subunit B GACGCACCGCAGGATACCACCTG gyrB-Forw DNA gyrase subunit B AAGTGAGGTAAAACCAGCGGTA gyrB-Rev DNA gyrase subunit B AATCTTGCCTGCAATTGATTTT * Forw, forward; rev, reverse.