| Dictionary, Encyclopedia and Thesaurus - The Free Dictionary 1,804,052,930 visitors served. |
|
Dictionary/ thesaurus | Medical dictionary | Legal dictionary | Financial dictionary | Acronyms | Idioms | Encyclopedia | Wikipedia encyclopedia | ? |
phylum |
Also found in: Medical, Encyclopedia, Wikipedia, Hutchinson | 0.03 sec. |
|
See: race How to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit webmaster's page for free fun content. |
|
| ? Mentioned in | ? References in periodicals archive | |
|---|---|---|
phagocyto- ge9f AACGGATTATTCTTTATAGCTTGCT philum (inner) ge2 GGCAGTATTAAAAGCAGCTCCAGG E. Results of PCR analysis and serum antibody titers to different tickborne pathogens tested at different times after the onset of illness * PCR ([dagger]) 16S RNA gene Days after Anaplasma ELISA IgM onset of phagocyto- Ehrlichia /IgG ([double illness philum chaffeensis dagger]) TBEV 12 Pos Neg 0. |
| Legal Dictionary |
| Free Tools: |
For surfers:
Free toolbar & extensions |
Word of the Day |
Help
For webmasters: Free content | Linking | Lookup box | Double-click lookup | Partner with us |
|---|