factor

(redirected from factor II)
Also found in: Dictionary, Thesaurus, Medical, Financial, Encyclopedia, Wikipedia.
Related to factor II: factor IIa

Factor

An event, circumstance, influence, or element that plays a part in bringing about a result.

A factor in a case contributes to its causation or outcome. In the area of Negligence law, the factors, or chain of causation, are important in determining whether liability ensues from a particular action done by the defendant.

factor

n. 1) a salesman who sells in his/her own name on behalf of others, taking a commission for services. 2) something that contributes to the result.

factor

(Commission merchant), noun agent, broker, commercial agent, delegate, deputy, envoy, interagent, manager, medium, middleman, one who sells for factorage, proctor, procurator, representative
Associated concepts: consignee, factors' lien

factor

(Ingredient), noun additive, agent, aid, aspect, cause, component, constituent, constitutive element, content, contributing force, determinant, element, elementary unit, feature, integral part, part, portion, segment, unit
See also: aspect, broker, cause, characteristic, component, constituent, dealer, deputy, determinant, element, feature, ingredient, member, part, plenipotentiary, portion, procurator, reason, represent, substitute

factor

1 a mercantile agent. An agent who is in the ordinary course of business entrusted with goods or documents of title representing goods with a view to their sale. A factor has a lien over goods entrusted to him; this lien covers any claims he may have against his principal arising out of the agency. Most factors will be mercantile agents (and have the powers of such) for the purposes of the Factors Act 1889. Under this Act, in certain circumstances a factor may pass a good title to goods entrusted to him.
2 an institution to whom a company assigns its book debts (see FACTORING).
3 in Scotland a landlord or superior's agent.
References in periodicals archive ?
It should also be noted that Factor II (Vocational Exploration) was rated as the most important factor by respondents in the private not for-profit and state sectors.
Ashkenazi Jewish women in the complicated pregnancy group also had a higher rate of factor II mutations, compared with Ashkenazi Jewish controls (18% vs.
It appears that somewhat clearer distinctions are apparent among employers with respect to Factor I of the employment-related measure, focusing on the Appropriateness of Competitive Employment with an emphasis on the benefits for the individual with disabilities, than with respect to Factor II.
Evaluation of electronic microarrays for genotyping factor V, factor II, and MTHFR.
Therefore, the conscientious hints included in the factor II assay package insert noting that these rare mutations will possibly lead to a false-positive result might be exaggerated.
Mutation Primer Sequence, 5' - 3' Factor II G20210A PCR forward Biotin-CCTGAAGAAGTGGATACAGAAGG PCR reverse CAGTAGTATTACTGGCTCTTCCTGA Sequencing ACTGGGAGCATTGAG Factor V Leiden PCR forward GGGCTAATAGGACTACTTCTAATC (G1691A) PCR reverse Biotin-TCTCTTGAAGGAAATGCCCCATTA Sequencing AGCAGATCCCTGGAC MTHFR C677T PCR forward TTGAGGCTGACCTGAAGCAC PCR reverse Biotin-5GTGATGCCCATGTCGGTG Sequencing GGTGTCTGCGGGAG Factor XIII Val34Leu PCR forward AGCAGTTCCACCCAATAACTCT PCR reverse Biotin-TCATACCTTGCAGGTTGACG Sequencing CACAGTGGAGCTTCAG MTHFR A1298C PCR forward GTGGCACTGCCCTCTGTC PCR reverse Biotin-CTCCCGAGAGGTAAAGAACGA Sequencing AGGAGTTGACCAGTGA PAI-1 4G/5G PCR forward Biotin-GGCACAGAGAGAGTCTGGACAC PCR reverse CGCCTCCGATGATACACG Sequencing ACACGGCTGACTCCC
The effect of additional sequence variations near the expected mutations for factor II and MTHFR was also evaluated.
Contract awarded for event 2481/2014 factor ii, factor ix, factor vii, factor x dust and solution for road use parenteral 500 iu
MARKET FOR COAGULATION GENE MARKER TESTS: FACTOR II PROTHROMBIN, FACTOR V LEIDEN, AND MTHFR
Contract awarded for event 2362/2014 factor ii, factor ix, factor vii, factor x dust and solution for road use parenteral 500 iu