virus

(redirected from Powassan virus)
Also found in: Dictionary, Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to Powassan virus: Ixodes cookei
See: disease
References in periodicals archive ?
Massachusetts is one of four states that is working with the CDC on a pilot program to increase surveillance and local testing capabilities for Powassan virus and some other arboviruses.
Almost all of these cases are in Lyme country, where humans are much more likely to be preyed upon by deer ticks carrying deer tick virus than ticks carrying Powassan virus," El Khoury said in a statement Monday.
The principal vector of Powassan virus is Ixodes cookei, the woodchuck tick.
For clarity, in this article, we will use the term POWV/DTV to designate infection with Powassan virus of undetermined lineage.
Lyme disease is the most well-known infection spread by ticks, but others, such as Powassan virus, are now causing human disease.
Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.
Primers for MassTag central nervous system infections panel, RNA pathogens Target Primer sequence, Pathogen gene 5' [right arrow] 3' * Eastern equine E1 Fwd: ACACTAAATTCACCCTAGTTCGAT encephalitis virus Rev: GTGTATAAAATTACTTAGGAGCAGCATTATG Nipah/Hendra virus Phos Fwd: GGGGGAATGYCTAAGRATGATG Rev: TCCGGTACATTCTCCTCCATG Japanese NS5 Fwd: TCAACCTAGGGAGCGGAACA encephalitis virus Rev: GGCTGAGCCAGTAGCCTTCA Parechovirus 5UTR Fwd: ACACTAGTTGTAAGGCCCACGAA Rev: GGTBTGGCCCACTAGACGTTTT Powassan virus NS5 Fwd: CATCCGACCATGCACCTAGA Rev: CCAAAGTGAGGATGTGTACCAAAG La Crosse virus S Fwd: CTCAACCTTGCTGCAGTTAGGA Rev: CCACCTGCCACTCTCCAAA Lymphocytic pol Fwd: CCACTYTTGTCTGCACTGTCTAT choriomeningitis Rev: CTTTTTGATGCGCAATGGAT virus St.
Powassan virus (POWV), a rare neuroinvasive arbovirus, was first described in 1958 (1,2).
To the Editor: Birge and Sonnesyn report the first death of a Minnesota resident caused by Powassan virus (POWV) (1).
Powassan virus (POWV) is a rare tick-borne agent of encephalitis in North America.
3% identical to the 654-bp PrM genes of other tick-borne encephalitis complex viruses such as Omsk hemorrhagic fever virus (Kubrin strain), tick-borne encephalitis virus (Sengzhang strain), Powassan virus (LB strain), and Langat virus (TP21 strain).