Ton

(redirected from TES)
Also found in: Dictionary, Thesaurus, Medical, Financial, Acronyms, Encyclopedia, Wikipedia.

TON. Twenty hundred weight, each hundred weight being one hundred and twelve pounds avoirdupois. See act of congress of Aug. 30, 1842, c. 270, s. 20.

References in periodicals archive ?
Masdar Institute's expertise in CSP and TES systems has attracted a number of interested academic and industrial partners from around the world.
Figure 2 shows a typical temperature profile in a stratified TES tank.
TES is home to the world's largest online community of teachers, with more than eight million registered users, downloading one million classroom resources every day across its global marketplace.
Dr Nicolas Calvet added that the availability of sand in desert environments such as the UAE allows for significant cost reductions in novel CSP plants, which may use it both as TES material and as a solar absorber.
The primers used for TES and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control in the reaction were: 5'- CCTGTCCAGAACCAGGCATT - 3'/5' - TTCTTTCGGTACTGTGCCCC-3' ( TES gene, 98 bps), and 5'-TGAGAATCTGCCCCTCTTCAC - 3'/5'- CGTTGCTGTCGAGACTTTATTGA-3' (GAPDH, 110 bps).
Based on the proceedings of Unconvention, TES announced setting up of "Women Wednesday", a support group for women startups.
In a unique experiment, TES Orbit blends educational issues with commercial journalism and its readership base includes educational institutes, students, teachers, parents, competitive exam aspirants and lay readers.
We were already subcontracting to W TES and saw the potential of bringing it under the Aquasentry brand and utilising the expertise of the highly-knowledgeable engineers who have the ability to help us achieve our ambitions.
Premium products of TES include MPLS, Premium Internet bandwidth for businesses (IP Transit), Collocation in Landing Station Data Center and Managed Cloud Services.
These thirteen systems include atmospheric and pressurized TES tanks and chilled water, low-temperature chilled water, and ice systems.
The TES motor power requirement for small/light e-scooters is between 650W to 800W, and battery capacity must be between 10Ah and 15Ah.