expression

(redirected from expression vector)
Also found in: Dictionary, Thesaurus, Medical, Encyclopedia, Wikipedia.

expression

declaring or signifying. Freedom of expression is a HUMAN RIGHT.

EXPRESSION. The term or use of language employed to explain a thing.
     2. It is a general rule, that expressions shall be construed, when they are capable of several significations, so as to give operation to the agreement, act, or will, if it can be done; and an expression is always to be understood in the sense most agreeable to the nature of the contract. Vide Clause; Construction; Equivocal; Interpretation; Words.

References in periodicals archive ?
The plasmid was based on the pET expression vectors (6).
(A) Schematic of the expression vector used for transgene translocation with Cre recombinase.
TABLE 1: The primers used in cloning the LbCHI31 and LbCHI32 genes into prokaryotic intracellular and extracellular expression vectors. Primers Primers sequences (5'-3') Underlined names enzymatic sites inCHI31-R ATCGGGTACCAGGAGCAGTGCGGTTCTCAAGCCGGT KpnI inCHI31-L CGATGAGCTCAGCAAAAGGCCTCTGGCTATTGC SacI inCHI32-R ATCGCCCGGGCTGGACCTGACGGACCAGCTCGTT SmaI inCHI32-L CGATGGATCCTGTGACGATGCAGAGCCGGATGGGTT BamHI exCHI31-R ATCGGAAGACTGCATG AAAACGACACT CAT CCTAACCG BbsI exCHI31-L CGATGGTACCTCAAGCAAAAGGCCTCTGGCTATTG KpnI exCHI32-R ATCGCCATG GGGAGGCATTGGAGACTGGTAATC NcoI exCHI32-L CGATGGTACCTCAATTATGACGATGCAGAGCCGGAT KpnI
The coding sequence of the secretin domain of pilQ (pil[Q.sub.1138-2118]) was constructed in the pET28a expression vector. Transformants were characterized by enzymatic digestion.
Key: Lane 1: standard protein molecular weight marker; Lane 2: pPIC9K empty expression vector (negative control); Lane 3-7: transformed Pichia pastoris supernatant after 0, 24, 48, 72, 96 h of induction with methyl alcohol, respectively.
The initial secretory expression of rhBMP2, using expression vector pHT43-BMP2-M, was confirmed at 37[degrees]C in 2xYT medium in SCK6 strain as shown in Figure 2.
Plant expression vectors were constructed by cloning of pcoCas9 and gRNA into pGreen0029 vector.
AE016958 (tag MAP 0862 and MAP 1087 coding for hypothetical proteins) and also the information about multiple cloning sites of the expression vector pQE-30, restriction sites BamHI and PstI were incorporated into the oligonucleotide primers to facilitate directional cloning.
Engineering of expression vector: IBDV vp2 gene was obtained from Veterinary Medicine College northeast agriculture university Harbin china.it was amplified by using polymerase chain reaction (PCR) with the specified pair of forward and reverse primer synthesized by 'BoShi Sheng Wu' Company.
To construct the expression vector of codon-optimized pBD-2 and cecropin P1 fusion gene, the pBD-2 (GenBank: AY506573.1) and cecropin P1 (GenBank: AB186032.1) genes were codonoptimized using B.
Cloning and expression of PR coding region in pET102D/ TOPO expression vector